Top » Catalog » SNPs » FGC5521

$18.00

FGC5521
[FGC5521]

FGC5521
hg38 Position: ChrY:12751608..12751608
Ancestral: T
Derived: C
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person. downstream of FGC5496
Forward Primer: FGC5521_F TGGAGTTTTTGGTGAAATGC
Reverse Primer: FGC5521_R CCTTTCACAAAATGGTTCTGG
Reviews

Customers who bought this product also purchased
S1105
S1105
MC14
MC14
CTS3386
CTS3386
S1090
S1090
BY203693
BY203693
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies