Top » Catalog » SNPs » FGC5522

$18.00

FGC5522
[FGC5522]

FGC5522
hg38 Position: ChrY:12773424..12773424
Ancestral: A
Derived: T
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5522_F GCCGCTTTAAATTCATGGTG
Reverse Primer: FGC5522_R TTGGAGAAACATAAATCAGTAATTAGG
Reviews

Customers who bought this product also purchased
FGC5505
FGC5505
FGC5543
FGC5543
FGC5513
FGC5513
FGC5557
FGC5557
FGC5533
FGC5533
R1b-FGC5496 downstream
R1b-FGC5496 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies