Top » Catalog » SNPs » S1041

$18.00

S1041
[S1041]

S1041
hg38 Position: ChrY:7537868..7537868
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2a1c (not listed)
Comments: Downstream from DF17 / CTS7768
Forward Primer: S1041_F CTCTTGGTCTCACGCTGTTTC
Reverse Primer: S1041_R GCTTGTACCTTCATGCTGTGTTC
Reviews

Customers who bought this product also purchased
S16264
S16264
Z16500
Z16500
FGC10059
FGC10059
DF13
DF13
FGC17938
FGC17938
FGC11134
FGC11134
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies