Top » Catalog » SNPs » S1041

$18.00

S1041
[S1041]

S1041
hg38 Position: ChrY:7537868..7537868
Ancestral: T
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a2a1a2a1c (not listed)
Comments: Downstream from DF17 / CTS7768
Forward Primer: S1041_F CTCTTGGTCTCACGCTGTTTC
Reverse Primer: S1041_R GCTTGTACCTTCATGCTGTGTTC
Reviews

Customers who bought this product also purchased
S16264
S16264
Z16500
Z16500
L513
L513
Z251
Z251
MC14
MC14
DF21
DF21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16435
1 x B397
$36.00
Haplogroup Info
Other products
Currencies