Top » Catalog » SNPs » Z2125

$18.00

Z2125
[Z2125]

Z2125
hg38 Position: ChrY:7024192..7024192
Ancestral: C
Derived: T
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1a (not listed)
Comments: downstream of Z93;Z94;Z95;Z2124 upstream from Z2123
Forward Primer: Z2125no_F CACTCTCCAAACCCCAGTG
Reverse Primer: Z2125no_R AAGGATACGAACACAAACTTCTTG
Reviews

Customers who bought this product also purchased
BY60768
BY60768
BY162940
BY162940
FT22438
FT22438
CTS6
CTS6
Y2630
Y2630
YP5480
YP5480
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies