Top » Catalog » SNPs » Z2125

$18.00

Z2125
[Z2125]

Z2125
hg38 Position: ChrY:7024192..7024192
Ancestral: C
Derived: T
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1a (not listed)
Comments: downstream of Z93;Z94;Z95;Z2124 upstream from Z2123
Forward Primer: Z2125no_F CACTCTCCAAACCCCAGTG
Reverse Primer: Z2125no_R AAGGATACGAACACAAACTTCTTG
Reviews

Customers who bought this product also purchased
FGC18218
FGC18218
Y2395
Y2395
FGC18226
FGC18226
M458
M458
Y2619
Y2619
CTS6
CTS6
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies