Top » Catalog » SNPs » Z2125

$18.00

Z2125
[Z2125]

Z2125
hg38 Position: ChrY:7024192..7024192
Ancestral: C
Derived: T
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1a (not listed)
Comments: downstream of Z93;Z94;Z95;Z2124 upstream from Z2123
Forward Primer: Z2125no_F CACTCTCCAAACCCCAGTG
Reverse Primer: Z2125no_R AAGGATACGAACACAAACTTCTTG
Reviews

Customers who bought this product also purchased
M417
M417
R1a Superclade Panel
R1a Superclade Panel
M12280
M12280
YP1127
YP1127
YP5648
YP5648
YP1270
YP1270
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies