Top » Catalog » SNPs » FGC5530

$18.00

FGC5530
[FGC5530]

FGC5530
hg38 Position: ChrY:15230831..15230831
Ancestral: C
Derived: G
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5530_F CATTTCTTTTAATGGTTGAGTTTGTGC
Reverse Primer: FGC5530_R AACTGTAGATGTTGACATGGATGTG
Reviews

Customers who bought this product also purchased
FGC5522
FGC5522
FGC5537
FGC5537
FGC5507
FGC5507
FGC5544
FGC5544
FGC5521
FGC5521
FGC7448
FGC7448
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies