Top » Catalog » SNPs » FGC9682

$18.00

FGC9682
[FGC9682]

FGC9682
hg38 Position: ChrY:12780931..12780931
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream R-DF13
Forward Primer: FGC9682_F TGATGAAGTGCCTTGGAATG
Reverse Primer: FGC9682_R GCACCGGGATACAAAGAAAC
Reviews

Customers who bought this product also purchased
A4604
A4604
S1050
S1050
FGC17906
FGC17906
FGC17938
FGC17938
R1b-S1051 Panel
R1b-S1051 Panel
FGC9854
FGC9854
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A17431
1 x A16438
1 x A17436
$54.00
Haplogroup Info
Other products
Currencies