Top » Catalog » SNPs » FGC9684

$19.00

FGC9684
[FGC9684]

FGC9684
hg38 Position: ChrY:13498096..13498096
Ancestral: G
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream R-DF13
Forward Primer: FGC9684_F AGCAAATCTGAAACCCAACC
Reverse Primer: FGC9684_R AAGGCCAACAAGAAATGTGG
Reviews

Customers who bought this product also purchased
FGC9688
FGC9688
FGC9679
FGC9679
FGC9673
FGC9673
FGC9663
FGC9663
FGC9704
FGC9704
R1b-S1051 McCeney Panel
R1b-S1051 McCeney Panel
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies