Top » Catalog » SNPs » A22471

$18.00

A22471
[A22471]

A22471
hg38 Position: ChrY:12426473..12426473
Ancestral: A
Derived: G
Reference: Tommy Reynolds (2018)
ISOGG Haplogroup: R1b
Comments:
Forward Primer: A22471_F TGCAGTAAGCCATGATCAGC
Reverse Primer: A22471_R AGGCTCCACCAACAATAAGG
Reviews

Customers who bought this product also purchased
BY15266
BY15266
DNA Sample Kit
DNA Sample Kit
BY15265
BY15265
A22474
A22474
A22473
A22473
A22472
A22472
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies