Top » Catalog » SNPs » FGC9685

$18.00

FGC9685
[FGC9685]

FGC9685
hg38 Position: ChrY:13601947..13601947
Ancestral: A
Derived: G
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b1a2a1a2c1 (not listed)
Comments: Downstream R-DF13
Forward Primer: FGC9685_F GGGTGGATCCTTCACAAAAG
Reverse Primer: FGC9685_R TCATGTCCAGGACCAATCAG
Reviews

Customers who bought this product also purchased
FGC9673
FGC9673
FGC9663
FGC9663
FGC9704
FGC9704
R1b-S1051 McCeney Panel
R1b-S1051 McCeney Panel
FGC9692
FGC9692
FGC9688
FGC9688
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies