Top » Catalog » SNPs » Z141

$18.00

Z141
[Z141]

Z141
hg38 Position: ChrY:7662772..7662772
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a1a
Comments: downstream of I1. parallel to L22
Forward Primer: Z141_F GTTTTAGATAATTTTAAAAAGCACTTTCA
Reverse Primer: Z141_R GAGTGCAGGTGTGAGTCTCCCTGA
Reviews

Customers who bought this product also purchased
F2642
F2642
A1374
A1374
Z58
Z58
S1953
S1953
A1603
A1603
I1 Superclade Panel
I1 Superclade Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK345
$18.00
Haplogroup Info
Other products
Currencies