Top » Catalog » SNPs » Z141

$18.00

Z141
[Z141]

Z141
hg38 Position: ChrY:7662772..7662772
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a1a
Comments: downstream of I1. parallel to L22
Forward Primer: Z141_F GTTTTAGATAATTTTAAAAAGCACTTTCA
Reverse Primer: Z141_R GAGTGCAGGTGTGAGTCTCCCTGA
Reviews

Customers who bought this product also purchased
BY178134
BY178134
FGC65549
FGC65549
CTS6739
CTS6739
S1990
S1990
Y6232
Y6232
Y7397
Y7397
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies