Top » Catalog » SNPs » A11225

$18.00

A11225
[A11225]

A11225
hg38 Position: ChrY:16724537..16724537
Ancestral: T
Derived: C
Reference: Hamma Bachir (2016)
ISOGG Haplogroup: E1b (not listed)
Comments: .
Forward Primer: A11225_F AAAATTAGCCAGGCTTGGTG
Reverse Primer: A11225_R TGTAGAGCCAAGTGCAGACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies