Top » Catalog » SNPs » ALK357

$18.00

ALK357
[ALK357]

ALK357
hg38 Position: ChrY:13703914..13703914
Ancestral: G
Derived: A
Reference: Ahmad Al Khuraiji (2018)
ISOGG Haplogroup: J1a
Comments: Below FGC1696
Forward Primer: ALK357_F ATTTTCACAGCCCTTCTTGC
Reverse Primer: ALK357_R GGAATTTGACCCCTGTGAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies