Top » Catalog » SNPs » FGC5533

$18.00

FGC5533
[FGC5533]

FGC5533
hg38 Position: ChrY:15936205..15936205
Ancestral: T
Derived: A
Reference: Full Genomes Inc. (2013)
ISOGG Haplogroup: R1b1a1a2a1a2c1~
Comments: Found in a R-DF13 person
Forward Primer: FGC5533_F TGCACCAACCTAATAGGATCAC
Reverse Primer: FGC5533_R AAGGGATCATCCATGCTGTC
Reviews

Customers who bought this product also purchased
FGC5522
FGC5522
FGC5537
FGC5537
FGC5507
FGC5507
FGC5544
FGC5544
FGC5521
FGC5521
FGC7448
FGC7448
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies