Top » Catalog » SNPs » A22547

$18.00

A22547
[A22547]

A22547
hg38 Position: ChrY:14258916..14258916
Ancestral: T
Derived: C
Reference: Bruce Cockburn (2018)
ISOGG Haplogroup: R1b
Comments: Below L257/ZP2
Forward Primer: A22547_F CTGTGCTACATGCAGTGACG
Reverse Primer: A22547_R CAAGCCTGTTCAACATGGAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies