Top » Catalog » SNPs » A22548

$18.00

A22548
[A22548]

A22548
hg38 Position: ChrY:15350370..15350370
Ancestral: G
Derived: A
Reference: Bruce Cockburn (2018)
ISOGG Haplogroup: R1b
Comments: Below L257/ZP2
Forward Primer: A22548_FCACCCAATAGGAAAGATCCTATTATAAAC
Reverse Primer: A22548_R CTTACATCATTGAATTTTCTTTAAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies