Top » Catalog » SNPs » Y104055

$18.00

Y104055
[Y104055]

Y104055
hg38 Position: ChrY:17110982..17110982
Ancestral: A
Derived: G
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: YP515 > YP5902
Forward Primer: Y104055_F CTTTGAAGATTCCTTTGTTTATATTTCATG
Reverse Primer: Y104055_R GAAGCTAATCATATGACCTTTCCTTCC
Reviews

Customers who bought this product also purchased
Y91778
Y91778
Y98202
Y98202
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies