Top » Catalog » SNPs » Y91778

$18.00

Y91778
[Y91778]

Y91778
hg38 Position: ChrY:12482621..12482621
Ancestral: A
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1a
Comments: .
Forward Primer: Y91778_F GCCTGGCTCTGTCACCG
Reverse Primer: Y91778_R TTCCTGTTAAAAATAGAAATTGGGC
Reviews

Customers who bought this product also purchased
Y98202
Y98202
Y104055
Y104055
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies