Top » Catalog » SNPs » BY139853

$18.00

BY139853
[BY139853]

BY139853
hg38 Position: ChrY:20500019..20500019
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY139853_F TGATATCACTATTTGCATAAACTAACAAGC
Reverse Primer: BY139853_R AATCACCTGAAGGTACAAAACTTATGG
Reviews

Customers who bought this product also purchased
BY57072
BY57072
BY145816
BY145816
BY72702
BY72702
R1b-FGC13604 King
R1b-FGC13604 King
BY41628
BY41628
BY53568
BY53568
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies