Top » Catalog » SNPs » BY145816

$18.00

BY145816
[BY145816]

BY145816
hg38 Position: ChrY:21341960..21341960
Ancestral: G
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY145816_F CACTGGGAAGAAAAACAAAGG
Reverse Primer: BY145816_R TATTATATATATTAGAAAAACCATTACCAAAGGC
Reviews

Customers who bought this product also purchased
BY53568
BY53568
BY53567
BY53567
BY57072
BY57072
BY139853
BY139853
BY72702
BY72702
R1b-FGC13604 King
R1b-FGC13604 King
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies