Top » Catalog » SNPs » BY145816

$18.00

BY145816
[BY145816]

BY145816
hg38 Position: ChrY:21341960..21341960
Ancestral: G
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY145816_F CACTGGGAAGAAAAACAAAGG
Reverse Primer: BY145816_R TATTATATATATTAGAAAAACCATTACCAAAGGC
Reviews

Customers who bought this product also purchased
BY41628
BY41628
BY53568
BY53568
BY53567
BY53567
BY57072
BY57072
BY139853
BY139853
BY72702
BY72702
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies