Top » Catalog » SNPs » BY53567

$18.00

BY53567
[BY53567]

BY53567
hg38 Position: ChrY:6534316..6534316
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY53567_F CGCTGTTATAAAATACCGACCTATATCTTAG
Reverse Primer: BY53567_R GGTATTTCACGACACCGACTAAC
Reviews

Customers who bought this product also purchased
R1b-FGC13604 King
R1b-FGC13604 King
BY41628
BY41628
BY53568
BY53568
BY57072
BY57072
BY145816
BY145816
BY139853
BY139853
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies