Top » Catalog » SNPs » BY53568

$18.00

BY53568
[BY53568]

BY53568
hg38 Position: ChrY:6534339..6534339
Ancestral: A
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY53568_F TATAAAATACCGACCTATATCTTAGATTTG
Reverse Primer: BY53568_R GGTATTTCACGACACCGACTAAC
Reviews

Customers who bought this product also purchased
BY41628
BY41628
BY53567
BY53567
BY57072
BY57072
BY145816
BY145816
BY139853
BY139853
BY72702
BY72702
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies