Top » Catalog » SNPs » Y87

$18.00

Y87
[Y87]

Y87
hg38 Position: ChrY:19777165..19777165
Ancestral: C
Derived: T
Reference: Semargl (2013)
ISOGG Haplogroup: G2a3b1a3a1 (not listed)
Comments: Found from public sources
Forward Primer: Y87_F CAGGCATACAAAGCCAGACC
Reverse Primer: Y87_R TATTGGCCTCCAGTTCCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies