Top » Catalog » SNPs » Y131236

$18.00

Y131236
[Y131236]

Y131236
hg38 Position: ChrY:14525813..14525813
Ancestral: A
Derived: C
Reference: YFull (2018)
ISOGG Haplogroup: I2
Comments: Below FGC56855
Forward Primer: Y131236_F GGATGTTTTTTTCTCTGTGTACTCC
Reverse Primer: Y131236_R TTCTAGTTGGAGAAGAAAGAAGCTATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies