Top » Catalog » SNPs » Y110330

$18.00

Y110330
[Y110330]

Y110330
hg38 Position: ChrY:20848715..20848715
Ancestral: G
Derived: A
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below Z2571 > FGC11369 > Y33106
Forward Primer: Y110330_F ACCCACTTGATGAGGCAGTC
Reverse Primer: Y110330_R ACTGTGCACATGTACCCTAAAGTTC
Reviews

Customers who bought this product also purchased
Y90734
Y90734
BY43330
BY43330
Y90813
Y90813
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies