Top » Catalog » SNPs » A11445

$18.00

A11445
[A11445]

A11445
hg38 Position: ChrY:13352325..13352325
Ancestral: T
Derived: C
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b
Comments: Downstream FGC10125
Forward Primer: A11445_F ATTGTTTGAGGGCACCACAG
Reverse Primer: A11445_R AATTAGCAGGGCATGGTGTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies