Top » Catalog » SNPs » A11450

$18.00

A11450
[A11450]

A11450
hg38 Position: ChrY:8724207..8724207
Ancestral: T
Derived: C
Reference: Alex Williamson (2016)
ISOGG Haplogroup: R1b
Comments: Downstream FGC10125
Forward Primer: A11450_F ACAAGTTTCAAGAAGACTCACCATG
Reverse Primer: A11450_R CAGCTCTGATAGTCAGGTACCCTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies