Top » Catalog » SNPs » CTS7556

$18.00

CTS7556
[CTS7556]

CTS7556
hg38 Position: ChrY:15423892..15423892
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a2c1a1
Comments: Below L23 > Z2103 > Z2109
Forward Primer: CTS7556_F TGGGGACTGACAATTAATCAAAG
Reverse Primer: CTS7556_R CCAGGACTCCTCACTGGG
Reviews

Customers who bought this product also purchased
FGC29330
FGC29330
CTS7822
CTS7822
Z2109
Z2109
CTS9219
CTS9219
CTS699
CTS699
Z2106
Z2106
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies