Top » Catalog » SNPs » CTS7556

$18.00

CTS7556
[CTS7556]

CTS7556
hg38 Position: ChrY:15423892..15423892
Ancestral: C
Derived: T
Reference: Chris Tyler-Smith (2011)
ISOGG Haplogroup: R1b1a1a2a2c1a1
Comments: Below L23 > Z2103 > Z2109
Forward Primer: CTS7556_F TGGGGACTGACAATTAATCAAAG
Reverse Primer: CTS7556_R CCAGGACTCCTCACTGGG
Reviews

Customers who bought this product also purchased
KMS86
KMS86
Y14511
Y14511
CTS7763
CTS7763
Z2103
Z2103
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Y20607
Y20607
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies