Top » Catalog » SNPs » A22569

$18.00

A22569
[A22569]

A22569
hg38 Position: ChrY:13290144..13290144
Ancestral: C
Derived: A
Reference: Ondrej Bures (2018)
ISOGG Haplogroup: R1a
Comments:
Forward Primer: A22569_F TAAAGAAAATATTGACAGATATGAAGGAGG
Reverse Primer: A22569_R TCTAGCTAAGAGTTGGTCAATATTGTCC
Reviews

Customers who bought this product also purchased
A22570
A22570
A22568
A22568
A22567
A22567
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies