Top » Catalog » SNPs » Y144553

$18.00

Y144553
[Y144553]

Y144553
hg38 Position: ChrY:15863809..15863809
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y144553v2_F CTATTGGCATTACAGTATAGGCATATG
Reverse Primer: Y144553v2_R CTTCCTTCCTTAATTTAGAGCTGG
Reviews

Customers who bought this product also purchased
ZS1310
ZS1310
ZS1283
ZS1283
ZS1313
ZS1313
J1-ZS1282 Panel
J1-ZS1282 Panel
Y144562
Y144562
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L1322
1 x FT8540
1 x BY117738
1 x FT279050
1 x BY31253
1 x FT16287
1 x FT137233
1 x BY173220
1 x I2a-CTS595 Panel
1 x N Superclade Panel
1 x FT402667
1 x BY31849
1 x FT5833
1 x FT9751
1 x BY68076
1 x FGC4035
1 x FGC30208
1 x PH1546
1 x PH478
1 x R1a-Z93 Panel
$581.00
Haplogroup Info
Other products
Currencies