Top » Catalog » SNPs » Y144553

$18.00

Y144553
[Y144553]

Y144553
hg38 Position: ChrY:15863809..15863809
Ancestral: A
Derived: G
Reference: YFull (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: Y144553v2_F CTATTGGCATTACAGTATAGGCATATG
Reverse Primer: Y144553v2_R CTTCCTTCCTTAATTTAGAGCTGG
Reviews

Customers who bought this product also purchased
J1-ZS1282 Panel
J1-ZS1282 Panel
Y144562
Y144562
ZS1310
ZS1310
ZS1283
ZS1283
ZS1313
ZS1313
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies