Top » Catalog » SNPs » FGC65873

$15.00

FGC65873
[FGC65873]

FGC65873
hg38 Position: ChrY:15265704..15265704
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1713 > ZS8311 > FGC60167
Forward Primer: FGC65873_F ACTTAGATACCAAGTGCTACTCTTTGAC
Reverse Primer: FGC65873_R TTGTATGGCATGCAATAACTCC
Reviews

Customers who bought this product also purchased
FGC44057
FGC44057
Y67107
Y67107
Y8965
Y8965
AD0000004
AD0000004
J1-M267 Superclade Panel
J1-M267 Superclade Panel
ALK443
ALK443
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies