Top » Catalog » SNPs » FGC65873

$18.00

FGC65873
[FGC65873]

FGC65873
hg38 Position: ChrY:15265704..15265704
Ancestral: G
Derived: T
Reference: Full Genomes Corp. (2017)
ISOGG Haplogroup: J1
Comments: Below FGC1713 > ZS8311 > FGC60167
Forward Primer: FGC65873_F ACTTAGATACCAAGTGCTACTCTTTGAC
Reverse Primer: FGC65873_R TTGTATGGCATGCAATAACTCC
Reviews

Customers who bought this product also purchased
Y67107
Y67107
Y8965
Y8965
AD0000004
AD0000004
FGC44057
FGC44057
FGC60167
FGC60167
ZS8311
ZS8311
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies