Top » Catalog » SNPs » YP1698

$18.00

YP1698
[YP1698]

YP1698
hg38 Position: ChrY:19142080..19142080
Ancestral: G
Derived: A
Reference: YDNA-community (2015)
ISOGG Haplogroup: R1a
Comments: Below Z92 > YP682
Forward Primer: YP1698_F AAAGGAGCAGAAGTCTCAGAAG
Reverse Primer: YP1698_R TACAGCTCATGCCTTGTTAGATAC
Reviews

Customers who bought this product also purchased
BY182582
BY182582
Y58868
Y58868
YP1697
YP1697
YP6187
YP6187
YP1696
YP1696
Y11268
Y11268
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies