Top » Catalog » SNPs » Y32147

$18.00

Y32147
[Y32147]

Y32147
hg38 Position: ChrY:6805691..6805691
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: Below Z2103 > Y5592 > Y23373
Forward Primer: Y32147_F CTGATCTTGAGCTTCTGTGCTG
Reverse Primer: Y32147_R TTTATGTCTTCTGCATTCCACTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A121
1 x CTS5990
$36.00
Haplogroup Info
Other products
Currencies