Top » Catalog » SNPs » BY130229

$18.00

BY130229
[BY130229]

BY130229
hg38 Position: ChrY:18907444..18907444
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY130229_F CAGAAACCCTCCCTGTTCTG
Reverse Primer: BY130229_R CCTCAGGCCTCCCATGTAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies