Top » Catalog » SNPs » BY140769

$18.00

BY140769
[BY140769]

BY140769
hg38 Position: ChrY:20625729..20625729
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY140769_F GTGTGTGTGTGGAGGAGGAG
Reverse Primer: BY140769_R CAAATGCTGGTGAGGATATGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies