Top » Catalog » SNPs » BY92383

$18.00

BY92383
[BY92383]

BY92383
hg38 Position: ChrY:11903769..11903769
Ancestral: T
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY92383_F TCACTTGACCTTGTTAGCAGTTCC
Reverse Primer: BY92383_R TATCACATCCATCTACCAAGCTATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies