Top » Catalog » SNPs » BY112465

$18.00

BY112465
[BY112465]

BY112465
hg38 Position: ChrY:15009097..15009097
Ancestral: G
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: N
Comments: Below Y21575
Forward Primer: BY112465_F TGCATTCTCAACCTCATTGG
Reverse Primer: BY112465_R GCCCTGCAGTCCAGTTACAG
Reviews

Customers who bought this product also purchased
Y52469
Y52469
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies