Top » Catalog » SNPs » BY105663

$18.00

BY105663
[BY105663]

BY105663
hg38 Position: ChrY:13975234..13975234
Ancestral: G
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: BY105663_F TGGAGTAAGCCATCTGCAAC
Reverse Primer: BY105663_R CTGGAGAGATCTTGCCTTGG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies