Top » Catalog » SNPs » Y150920

$18.00

Y150920
[Y150920]

Y150920
hg38 Position: ChrY:21211188..21211188
Ancestral: C
Derived: A
Reference: Timothy Cummings (2018)
ISOGG Haplogroup: R1b
Comments: Below L21 > DF13 > DF1 > S5668 > FGC13499 > S5979 > S5982 > FGC32004 > Y31361
Forward Primer: Y150920_F CCAAAATTGACAAATGGGG
Reverse Primer: Y150920_R TGCCTACTTTTTGATGGAGGTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies