Top » Catalog » SNPs » A22673

$18.00

A22673
[A22673]

A22673
hg38 Position: ChrY:14747577..14747577
Ancestral: A
Derived: G
Reference: Connie McKenzie (2018)
ISOGG Haplogroup: I2
Comments: Downstream Y11857 > Y17214
Forward Primer: A22673_F CATGAATGGAAGTTCCCTTAGTC
Reverse Primer: A22673_R TTAGTAGGATGAAGGAGGATGATCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies