Top » Catalog » SNPs » Y105512

$18.00

Y105512
[Y105512]

Y105512
hg38 Position: ChrY:18978476..18978476
Ancestral: G
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y105512_F ATTTTATTTCTTTGGAAATGTCTGCTC
Reverse Primer: Y105512_R CAGTTTGAGAGGCTGCGC
Reviews

Customers who bought this product also purchased
Y112697
Y112697
Y107465
Y107465
Y100275
Y100275
Y97262
Y97262
Y95231
Y95231
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Haplogroup Info
Other products
Currencies