Top » Catalog » SNPs » Y107465

$18.00

Y107465
[Y107465]

Y107465
hg38 Position: ChrY:19615406..19615406
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y107465_F ACATAGGACCGACAGCAACC
Reverse Primer: Y107465_R CCCTCAGAACTAGGGCACTG
Reviews

Customers who bought this product also purchased
Y97262
Y97262
Y95231
Y95231
Y112697
Y112697
Y105512
Y105512
Y100275
Y100275
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies