Top » Catalog » SNPs » Y112697

$18.00

Y112697
[Y112697]

Y112697
hg38 Position: ChrY:22225461..22225461
Ancestral: G
Derived: T
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y112697_F TAAAAGCATTAAAAAACCAGATCAG
Reverse Primer: Y112697_R AGTAAAATAAAATAAAATATATGTGGATTTTTTC
Reviews

Customers who bought this product also purchased
Y105512
Y105512
Y100275
Y100275
Y97262
Y97262
Y95231
Y95231
Y107465
Y107465
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies