Top » Catalog » SNPs » Y97262

$18.00

Y97262
[Y97262]

Y97262
hg38 Position: ChrY:14665217..14665217
Ancestral: T
Derived: C
Reference: YFull (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: Y97262_F AATTGATACACAGGACTTGCGC
Reverse Primer: Y97262_R TCATGACAACCTTCACTGTCTCC
Reviews

Customers who bought this product also purchased
Y107465
Y107465
Y105512
Y105512
Y100275
Y100275
Y95231
Y95231
Y112697
Y112697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies