Top » Catalog » SNPs » FGC30237

$18.00

FGC30237
[FGC30237]

FGC30237
hg38 Position: ChrY:19027545..19027545
Ancestral: G
Derived: A
Reference: Full Genomes Corp. (2015)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: FGC30237_F ACAATTCCATTCCAAAGAAGAAATAG
Reverse Primer: FGC30237_R GCTCATTGCAACTTCTCCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies