Top » Catalog » SNPs » Z46065

$15.00

Z46065
[Z46065]

Z46065
hg38 Position: ChrY:7692720..7692720
Ancestral: G
Derived: C
Reference: Ray Banks (2018)
ISOGG Haplogroup: G
Comments: down from FGC41981
Forward Primer: Z46065_F TGCAGTCCAGTGGTTCTGG
Reverse Primer: Z46065_R AAGCCTTGCTTCTCACCCAC
Reviews

Customers who bought this product also purchased
Z46067
Z46067
Z46066
Z46066
A21080
A21080
Z46072
Z46072
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies