Top » Catalog » SNPs » Z46065

$18.00

Z46065
[Z46065]

Z46065
hg38 Position: ChrY:7692720..7692720
Ancestral: G
Derived: C
Reference: Ray Banks (2018)
ISOGG Haplogroup: G
Comments: down from FGC41981
Forward Primer: Z46065_F TGCAGTCCAGTGGTTCTGG
Reverse Primer: Z46065_R AAGCCTTGCTTCTCACCCAC
Reviews

Customers who bought this product also purchased
Z46072
Z46072
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies